Detection of Mucin Gene Polymorphism 337
337
28
Detection of Mucin Gene Polymorphism
Lynne E. Vinall, Wendy S. Pratt, and Dallas M. Swallow
1. Introduction
1.1. The MUC Genes
The polypeptide backbones of mucins and mucin-type glycoproteins are each
encoded by one of multiple genes . At least nine distinct genes (MUC1, MUC2, MUC3,
MUC4, MUC5AC, MUC5B, MUC6, MUC7, and MUC8) that encode mucin-type pro-
teins expressed in epithelial cells have been reported in humans (1,2). The genes
encoding mucins are dispersed in the human genome, although a family of four related
genes—MUC2, MUC5AC, MUC5B, and MUC6—each of which encodes an apomucin
expressed in specialized secretory cells, is found on chromosome 11p15.5 (1). The
other genes appear to be rather different. MUC1, the first epithelial mucin gene to be
identified, is located on chromosome 1q21, and encodes a relatively small molecule
with a transmembrane anchor, which is widely expressed in epithelia and can be
detected at low levels in certain other cells (3). MUC3 (7q22) and MUC4 (3q29) are
extremely large and also have transmembrane anchors (5–7,7a–c). MUC3 and MUC4,
like the 11p15.5 mucin genes, show a restricted tissue distribution, but are expressed
in columnar cells as well as in specialized secretory cells (8,9). MUC7 (4q) encodes a
very small secreted glycoprotein (MG2) expressed primarily in salivary glands (10,11),
but there is little information about MUC8 (12q24.3) (2).
A common feature of the MUC genes is that they contain tandem repeats (TR) of
DNA sequence that lead to tandem repetition of amino acid motifs. These repeated
regions may comprise 50% or more of the polypeptide. The repeat units vary in
sequence and in length, from 24 nucleotides in MUC5AC to 507 nucleotides in MUC6,
and also in the extent to which they are conserved within each array (7,12–17).
1.2. MUC Gene Polymorphism (
see
Notes 1–9)
It has been known for some time that the human mucin genes show a high level
of polymorphism (7,16–22). The occurrence of polymorphism owing to variable
numbers of the tandem repeats (VNTRs) in mucin genes was first shown for MUC1.
From:
Methods in Molecular Biology, Vol. 125: Glycoprotein Methods and Protocols: The Mucins
Edited by: A. Corfield © Humana Press Inc., Totowa, NJ
338 Vinall et al.
The same restriction fragment polymorphism was observed with a number of different
restriction enzymes, each of which cuts outside the TR region (22), and the polymor-
phism was readily detectable in the protein product by sodium dodecyl sulfate (SDS)
gel electrophoresis (22,23) and also in the messenger RNA (24,25). To date, the extent
and nature of polymorphism has been assessed in seven of the nine MUC genes on a
large number of unrelated individuals, mainly of European extraction, in our labora-
tory and elsewhere. MUC1 (see Note 1), MUC2 (see Note 2), MUC3 (see Note 3),
MUC4 (see Note 4), MUC5AC (see Note 5), and MUC6 (see Note 6) were all found to
be highly polymorphic at least partly owing to VNTR, whereas MUC5B showed no
evidence of VNTR variation (see Note 7) (26). The relevant published work is refer-
enced in Table 1. We have not studied polymorphism of MUC7 and MUC8, but it has
been reported that there is a variation in the number (five or six) of the 69-bp TRs of
the small MUC7 molecule (see Note 8) (Table 1).
It is not clear at this stage what impact variation in the length of the TR regions of
the MUC genes is likely to have, but it should be noted that the predicted differences in
polypeptide length of MUC1, MUC2, MUC4, and MUC6 are substantial, since the
allele length differences are attributable to coding sequence and do not apparently
contain introns. Although it has been known for a long time that the VNTR polymor-
phism of MUC1 is detectable in the protein, direct evidence for this in the case of the
other genes is only now becoming available. For example, recent data reveal evidence
of the same VNTR polymorphism in the mRNAs encoding MUC2, MUC4, and MUC6
(27) and corresponding size differences in MUC2 glycoprotein subunits (27a). In the
case of MUC2 the smallest allele that our group has observed is approx 3.5 kb and the
very largest allele ever observed, by our collaborators, is 14 kb (26), a difference of
more than 150 23 amino acid repeat units. These sizes indicate that the alleles encode
full-length MUC2 polypeptides (prior to glycosylation) of about Mr 350,000 and
680,000, respectively, a twofold difference in size (28). MUC4 shows a dramatic 20-
kb difference in size between the smallest and largest alleles so far observed. If these
alleles are transcribed and translated in their entirety, this difference corresponds to
about Mr 700,000. It seems probable that such substantial differences will be of func-
tional importance, as, e.g., appears to be the case for apolipoprotein(a), which shows
similar variation in polypeptide length (29). Variation in length of mucins is likely to
have an impact on the properties of the mucous gel; thus, studies to investigate pos-
sible disease susceptibility associated with extreme allele lengths are worthwhile.
With the exception of MUC7, these polymorphisms involve gene length differ-
ences that are kilobases in size, and thus have been analyzed by electrophoresis of
restriction enzyme-digested DNA and hybridization with gene-specific cDNA probes
after transfer of the DNA onto nylon membranes (Southern blotting). We have devized
a procedure whereby six of the genes can be analyzed using only two restriction
enzyme digests (HinfI and PvuII). Table 1 also lists other restriction enzymes that can
be used to detect VNTR variation in these genes. In each case, it is important to select
an enzyme which cuts close to the repeats and to avoid enzymes that cut within the
TRs such as Taq1 in MUC2 (16), MUC5AC, and MUC6 (26). Note, however, that rare
allelic variation involving nucleotide substitutions that involve the restriction sites
Detection of Mucin Gene Polymorphism339
339
Table 1
Size and Distribution of the TR Domains and Enzymes Used for Their Detection
Chromosomal Recommended
Gene location Main TR enzyme VNTR range Other possible enzymes Refs.
MUC1 1q21 60 bp 20 amino acids: HinfI 2.8–8.0 kb EcoRI/PstI, AluI, etc
a
22,24,33,
35,36
MUC2 11p15.5 69 bp 23 amino acids: HinfI 3.3–11.4 kb PstI, BamHI/HindIII 16,20,26
MUC3 7q22 51 bp 17 amino acids (two zones): PvuII 7.0–15.0 kb PstI 4,
18
20–50 kb
a
MUC4 3q29 48 bp 16 amino acids: PvuII 6.5–27 kb PstI/EcoRI 7,19
MUC5AC 11p15.5 24 bp 8 amino acids (interrupted): HinfI 6.6kb/7.4kb PstI 26
PvuII
a
MUC5B 11p15.5 87 bp 29 amino acids (interrupted): BglII 16 kb
a
26
MUC6 11p15.5 507 bp 169 amino acids: PvuII 8–13.5kb
aa
17,26
MUC7 4q13-21 69 bp 23 amino acids: PCR
a
5/6 repeats
a
10,11
MUC8 12q24.3 41 bp Unknown No information 2
a
See text for comments.
340 Vinall et al.
themselves may sometimes complicate the picture. The detailed protocols are given in
Subheading 3. Full protocols for MUC7 are not given, but the appropriate literature is
cited (see Note 8).
Although at present the only way of analyzing this variation is by Southern blotting,
as outlined in Subheading 3.1., it may eventually be possible to find polymerase chain
reaction (PCR) formattable polymorphisms that are in linkage disequilibrium with the
VNTR alleles, which would allow analysis of more samples and would use less DNA. A
protocol for such a polymorphism within MUC1 is presented here (see Note 9).
2. Materials (
see
Notes 10 and 11)
1. Puregene kit for genomic DNA preparation (Flowgen, Sittingbourne, UK).
2. Restriction enzymes: HinfI and PvuII (Gibco-BRL, Life Technologies, Paisley, Scotland).
3. TBE buffer (1X = 0.89 M Tris-HCl, 0.1 M borate, 0.002 M EDTA buffer, pH 8.3): pre-
pared as a 10X or 5X stock (see Note 10).
4. For agarose electrophoresis: Horizon 20:25 apparatus, a 30-sample comb (Gibco-BRL),
and a small gel tank (minihorizontal unit, Anachem, Luton, UK) or equivalents.
5. Agarose (Sigma, Poole, UK).
6. Loading buffer for agarose gels: 0.25% bromophenol blue, 0.25% xylene cyanol, 40%
sucrose in water.
7. Transilluminator (U.V.P. International, Ultra-Violet Products, Cambridge, UK).
8. Hybond N+ membranes (Amersham Pharmacia Biotech, Buckinghamshire, UK).
9. Vacuum blotter (Vacugene XL, Amersham Pharmacia Biotech).
10. Multiprime DNA labeling kit (Amersham Pharmacia Biotech).
11. Sodium chloride/sodium citrate (SSC)-containing solutions: prepare from a stock of 20X
SSC (3 M NaCl, 0.3 M trisodium citrate) (see Note 11).
12. Denhardt’s solution: make as a 100X stock (2% [w/v] Ficoll 2% [w/v] polyvinylpyrroli-
done, 2% [w/v] bovine serum albumin, pH 7.2) and filter sterilized.
13. Sonicated Herring sperm DNA (Promega, Southampton, UK).
14. Molecular weight markers for agarose electrophoresis: Raoul markers (Appligene,
Durham, UK), 1-kb ladder (Gibco-BRL), λHindIII (Gibco-BRL), and control genomic
DNA samples containing alleles of known length.
15. Shaking water bath at 65°C.
16. Cling film (e.g., Clingorap, Terinex, Bedford, UK).
17. Luminescent marking solution (Glo-bug X-ray marking solution, Radleys, Saffron
Walden, UK).
18. Oligonucleotide primers AGAGAGTTTAGTTTTCTTGCTCC (CAS) and TTCTTGGCT
CTAATCAGCCC (CAA) (nucleotides 5915–5937 and 6092–6073 in Genbank/EMBL
M61170), one of which is labeled with fluorescein.
19. PCR machine (e.g., Perkin Elmer, Beaconsfield, UK).
20. Taq polymerase in storage buffer A (Promega).
21. Deoxynucleotides: “DNA polymerization mix” (Amersham Pharmacia Biotech). Make a
2 mM stock (1/10 of solution supplied).
22. Automated sequencing machine (ALF, Amersham Pharmacia Biotech).
23. Polyacrylamide gels prepared using 6% acrylamide (19:1 acrylamide to bis, Bio-Rad,
Herts, UK) in the molds supplied with the automated Sequencing machine.
24. Marker for the ALF acrylamide gels: 250-bp Sizer (Amersham Pharmacia Biotech).
25. Loading buffer: 5 µg/mL of Dextran Blue in 100% formamide.
Detection of Mucin Gene Polymorphism 341
3. Methods
3.1. Southern Blot Analysis (
see
Notes 5 and 12–16)
1. Prepare genomic DNA samples from whole blood or other convenient source, using the
appropriate Puregene kit, or other standard protocol or kit.
2. Quantify the DNA by measurement of OD
259
. Dilute sample approx 1/100 and then mul-
tiply by the dilution factor and the conversion factor of 50 to convert OD to micrograms
per milliliter.
3. Check the integrity of the DNA by agarose electrophoresis of 1 µL of each sample plus 2 µL
of loading buffer on small gels (0.8% in 1X TBE) in the presence of 50 ng/µL ethidium
bromide, and inspection under ultraviolet (UV) light using a transilluminator.
4. Treat 5–7 µg of DNA with restriction enzymes HinfI or PvuII, in a final volume of 25 µL
(with the buffer provided and as recommended by the manufacturers).
5. Check digestion of the DNA by electrophoresis of 3 µL of each sample plus 2 µL of
loading buffer on small gels (0.8% in 1X TBE) in the presence of 50 ng/µL of ethidium
bromide, and inspection under UV light .
6. For analysis of MUC1, MUC2, and MUC5AC, separate the HinfI fragments (22 µL digest
plus 7 µL of loading buffer) by electrophoresis using 0.8% 20 × 25cm agarose gels in 1X
TBE, for 24 h at 2 V/cm.
7. For analysis of MUC3, MUC4, and MUC6, separate the PvuII fragments (22 µL digest
plus 7 µL of loading buffer) by electrophoresis using 0.5% 20 × 25cm agarose gels in 1X
TBE, at 2 V/cm for 24 h, followed by a complete change of the tank buffer, and continued
electrophoresis at 1.2 V/cm for a further 19 h.
8. Apply four kinds of markers to each gel: Raoul markers, 1-kb ladder, λHindIII, and DNA
samples with alleles of known size.
9. Following electrophoresis, visualize the markers by poststaining with 0.4 mg/mL of
ethidium bromide in distilled water for 20 min (see Note 12).
10. Record the migration of the marker bands by making a photographic record including a
clear ruler aligned to the leading edge of the wells.
11. Depurinate the DNA with 0.25 M HCl for 30 min, with occasional gentle agitation.
12. Denature with 1.5 M NaCl and 0.5 M NaOH for 30 min, with occasional gentle agitation.
13. Neutralize with 0.5 M Tris-HCl, 1.5 M NaCl, and 0.001 M EDTA, pH 7.2 for 30 min, with
occasional gentle agitation (see Note 13).
14. Transfer the digested DNA onto Hybond N+ membranes by capillary blotting overnight
or vacuum blotting for 2 h, both as recommended by the manufacturers, again aligning
the top of the membrane accurately.
15. Fix the DNA on to the filters by baking at 80°C for 2 h.
16. Detect the MUC genes using TR cDNA probes: PUM24P for MUC1 (30), SMUC41 for
MUC2 (13), SIB124 for MUC3 (31), JER64 for MUC4 (32), JER58 for MUC5AC (15),
and the cDNA reported in (17) for MUC6, and, when used, JER57 for MUC5B (14).
Label 25 ng by random primed labeling utilizing the Multiprime DNA labeling kit using
the solutions and protocol provided.
17. Prehybridize the filters in a plastic box in 200 mL of 6xSCC, 5X Denhardt’s and 0.5%
(w/v) SDS in a shaking water bath at 65°C (see Note 14).
18. After approx 4 h, prepare the hybridization solution. Add 500 µg of sonicated Herring
sperm DNA (Promega) to the labeled probe and boil for 5 min.
19. Add to the prehybridization solution and agitate the box to ensure that the probe is dis-
persed evenly.
20. Hybridize the filters overnight in the shaking water bath.
342 Vinall et al.
21. Wash the filters down in several changes of SSC, with a final stringent wash of 0.1X SSC
and 0.1% SDS at 65°C for 10 min.
22. Cover the wet filters with cling film, place luminescent Glo-bug marks on pieces of tape
near the filter, and conduct autoradiography using Fuji X-ray film.
23. Determine the relative sizes of the fragments by plotting a standard curve using the con-
trol MUC alleles (detected after transfer by autoradiography) as well as the commercial
size markers (Note 15). Carefully transfer the position of the top of the filter onto the
autoradiograph after development by using luminescent Glo-bug marks to reposition the
autoradiograph in the cassette. Measure all distances from this start line.
24. For the allele length distribution studies, plot results in histogram form grouping the frag-
ment size in 500-bp steps (see Note 16). Analyze MUC5AC as two size classes as indi-
cated (see Note 5).
3.2. MUC1 CA Microsatellite PCR (
see
Notes 9 and 17)
1. Add approx 100 ng of genomic DNA to a 50-µL reaction mix containing a final concen-
tration of 200 mM dNTPs in 1X Promega Taq polymerase buffer and then denature for 5
min at 95°C (see Note 17).
2. Add 1.25 U of Taq polymerase, and run the PCR machine for 30 cycles as follows: dena-
turation for 20 s, at 94°C, annealing for 20 s at 45°C, and elongation for 20 s at 70°C.
3. Mix 0.5–1 µL of PCR product with 0.5 µL of 250-bp Sizer (Pharmacia) and 4 µL of
loading buffer (5 µg/mL of Dextran Blue in 100% formamide).
4. Denature the samples for 5 min at 95°C and snap cool on ice before loading onto the gel,
which is prewarmed to 42°C. Set the gel conditions such that the gel runs at 42°C, limit-
ing at 1900 V, 55 mA, and 38 W, for 240 min. Use PCR product amplified from a clone or
DNA from a homozygous individual that has been sequenced as a size standard loaded
twice on each gel (see Note 9).
4. Notes
1. The TRs in MUC1 seem to be rather conserved, such that several enzymes (e.g., SmaI)
cut almost every repeat unit whereas many others (e.g., HinfI, EcoRI, AluI, PstI, PvuII,
TaqI) do not cut at all within the array (12,22,24,25). Thus, many different restriction
enzymes detect the MUC1 VNTR polymorphism. Here we recommend the use of HinfI
(Fig. 1), which reveals allelic band sizes of 2.8–8.0 kb with a bimodal distribution (Fig.
2) and heterozygosity of 0.78 in the U.K. population. Larger sizes are seen with EcoRI,
but this enzyme has also been effectively used for disease association studies with the
MUC1 VNTR alleles (33).
2. MUC2 shows two TR domains, the larger one containing conserved 69-bp repeats and
upstream from that a smaller one with poorly conserved 48-bp repeats. Although poly-
morphism in MUC2 can be detected with a large number of restriction enzymes (16,20)
several of these cut one or more times within the 69-bp TR array. HinfI, PstI, and BamHI/
HindIII detect VNTR polymorphism, but of these only HinfI cuts immediately either side
of the 69-bp TR domain. The HindIII site is located downstream of the 69-bp repeat
domain, whereas the BamHI site is located upstream of the 48-bp TR domain (16). The
observation that the BamHI/HindIII fragments show the same relative mobility as the
HinfI fragments suggests that the poorly conserved TR region does not show common
variation. Electrophoresis of HinfI-digested DNA under the conditions described (Fig. 1)
reveals more than 12 distinct alleles (size range: 3.3–11.4 kb in the U.K. population tested;
heterozygosity: 0.59). Our studies have shown the distribution of allele lengths to be
Detection of Mucin Gene Polymorphism 343
bimodal, with the majority of the alleles approx 6.5–7.0-kb in size and a second very
small peak comprising alleles of mean size of 3.5–4.0 kb. The distribution of allele lengths
in unrelated individuals from the United Kingdom and including only those of northern
European extraction is shown in Fig. 2 and shows that in the U.K. population the small
alleles are very rare.
3. The smallest single DNA fragment that can be detected with the MUC3 TR probe SIB124
is an SwaI fragment of approx 200 kb (by pulsed field gel electrophoresis). When digested
with PstI or PvuII, SIB124 recognises two distinct sets of very large polymorphic bands.
Each set shows independent allelic variation, and there is no apparent association between
the two polymorphic regions in either case, that is, the variation seen in the upper set of
fragments is not dependent on that seen in the lower set. Two hundred and twenty-six
unrelated northern Europeans have been tested with PvuII using the protocols described
Fig. 1. Southern blot analysis of MUC1, MUC2, MUC5AC, MUC3, and MUC4. Examples
of the HinfI and PvuII systems to show typical mobilities under the conditions described. MUC6
is also run on the PvuII system (not shown). The Raoul size markers (M) that are visible with
the MUC probes are shown or their position is indicated (48.5 kb), and the sizes are given in
kilobases. The dashes show the scale in centimeters.
344 Vinall et al.
Fig. 2. Histograms showing the distribution of different MUC 1, MUC2, and MUC4 size alleles
in the U.K. population. The fragment sizes are grouped in 500-bp intervals to reflect the approxi-
mate accuracy of the size determinations, and the size groups are labeled such that 7 kb, e.g., con-
tains all alleles between 7.0 and 7.4 kb inclusive; however, note that some bars on the histogram
correspond to several alleles of slightly different size. Samples were taken from unrelated volun-
teers and include healthy persons and members of our chest and intestinal disease surveys.
Detection of Mucin Gene Polymorphism 345
here. The apparent size range of the upper set varies from 20 kb to greater than the 48.5-kb
marker, with a multimodal distribution, and the most frequent allele at 24 kb, and a het-
erozygosity of 0.67 in the U.K. population. The lower set of polymorphic fragments
detected vary in size from 7 to 15 kb, with a unimodal distribution with a peak at about
12 kb and a heterozygosity of 0.51 in the U.K. population. Examples are shown in Fig. 1.
The PstI bands have not been sized accurately but they are very similar in size to the
PvuII bands. Initially, the broad similarity of the patterns observed with both PvuII and
PstI indicated that the polymorphism was simply owing to variation in the number of 51-
bp TRs in the two zones. However, it was later noted that the relative mobilities of the
bands detected with PvuII and PstI are not always consistent. The simplest interpretation
of these observations is that there is some VNTR variation with additional polymorphism
of a PstI site, although polymorphism at PvuII sites cannot be excluded. The explanation
for the very large size of the zones that contain 51-bp TR, detected with PvuII and PstI, is
unclear. The total size of two haploid sets of polymorphic PvuII fragments can vastly
exceed 50 kb, and this does not even cover the whole transcript since the recently
described (4) large TR zone contains regular PvuII sites. If, in fact, most of this sequence
was expressed, a very large message would be produced. Indeed, the largest and smallest
alleles of the upper set of fragments detected with PvuII differ in size by approx 30,000
bp. This is not compatible with the size of the mRNA transcripts detected by Northern
blotting, which has recently been estimated as 16 or 17.5 kb (two distinct size alleles in
three individuals [27]). These observations may indicate that either one or both of the
VNTR zones contains intronic sequences and that the total length of intronic sequence
may differ in different alleles, perhaps also owing to VNTR polymorphism. Alternatively,
one region may represent a pseudogene. If this were true, it would be tempting to specu-
late that the smaller set of bands represents the expressed gene.
4. Polymorphism of MUC4 is detected with all restriction enzymes tested (BamHI, HindII,
PstI, EcoRI, TaqI, PvuII, HinfI, and RsaI [19]; Vinall et al., unpublished data) using the
TR probe JER64. Of these, RsaI gives a complex pattern of bands, and HinfI a pattern of
one, two, or three bands. MUC4 shows more allele length diversity than any of the other
MUC genes. PvuII digestion and electrophoresis under the conditions described (Fig. 1)
reveals a range of allele sizes from 6.5–27 kb with a trimodal frequency distribution
(Fig. 2), and heterozygosity of 0.78 in the U.K. population. A similar pattern (with slightly
smaller bands) is revealed by double digestion with PstI and EcoRI, which cut closer to
the tandem repeats.
5. MUC5AC is also highly polymorphic and polymorphism can be readily detected with a
variety of enzymes (21,26). Evidence of VNTR variation comes from the correspondance
of patterns observed with several restriction enzymes. With HinfI and PstI band sizes
largely fall into two major classes (a: HinfI 6.6 kb and PstI 8.4 kb; b: HinfI 7.4 kb and PstI
9.0 kb), but these clearly represent more than two alleles since there are additional fine
variations that are not correlated in the two enzyme digests. Several other enzymes (e.g.,
PvuII, TaqI, and MspI) reveal more than one set of bands. The large bands detected with
PvuII correlate well in relative mobility with the PstI and HinfI bands, but the large bands
observed with TaqI and MspI are different from these. However, a correspondence in
relative mobility is evident between the small additional bands detected with PvuII, TaqI,
and MspI. The 24-bp TR array of MUC5AC is interrupted by cysteine-rich sequences
(15). Our results suggest a length variation involving two zones within this domain and
that HinfI cuts outside one of these zones but several times within the second variable
region, whereas PstI (and also HindIII) cut outside the whole TR region, as discussed in
346 Vinall et al.
(26). The polymorphism may simply involve differences in numbers of 24-bp TRs but
may also involve duplication of larger stretches of sequence. Since it is more likely that
the larger differences in size have an impact on function than the very small variations,
and also the small size differences observed with PstI are hard to evaluate, we have cho-
sen to use HinfI to assign the two major alleles, a and b. The allele frequencies found in
the U.K. population are a = 0.79 and b = 0.21, with two rare alleles in 334 individuals.
6. Several restriction enzymes (e.g., HaeIII, MspI, and PstI) reveal a relatively complex
pattern of multiple bands that show person to person variation while HindIII and EcoRI
each give a “single” very large band (>>30 kb) but also show hints of person-to-person
variation. However, with PvuII, a very clear length polymorphism is detected. A quite
similar pattern is seen with TaqI, but TaqI also cuts once or twice (in different alleles)
within the TRs, making it unsuitable for VNTR analysis. PvuII is the only enzyme iden-
tified so far that cuts outside the TRs but close enough to reveal the polymorphism clearly.
A simple pattern of bands is observed with this enzyme, composed of one or two large
bands in each individual, owing to 11 or more distinct alleles, ranging in size from 8 to
13.5 kb. The frequency distribution of these alleles is approximately unimodal, with a
peak at about 10 kb. A heterozygosity of 0.70 was obtained in our previous studies for the
unrelated chromosomes from the CEPH families (26). MUC6 has not yet been analyzed
in our U.K. population on precisely the same gel system as described here, so no size
distribution data are yet available and no examples are shown here.
7. MUC5B contrasts with the other mucins in showing little variation (26). Multiple bands
are detected in DNA digested with several enzymes (e.g., MspI, PstI, and TaqI). Rela-
tively infrequent variant patterns involving the presence or absence of one or more small
bands were detected with PstI and TaqI. A single large band is detected with EcoRI (27
kb) and with HindIII (25 kb). In most individuals (52/54), a single large band (16.5 kb) is
detected in DNA digested with BglII, which cuts immediately outside the TR domain, but
two individuals showed an additional band (19.5 or 15.5 kb). With EcoRI these two indi-
viduals both showed the common phenotype of a single 27-kb band, suggesting that the
variant phenotypes are owing to nucleotide changes within BglII sites rather than num-
bers of TR. MUC5B is therefore not included in our main protocol.
8. Limited VNTR variation has been reported in the small MUC7 gene. Analysis of 14 indi-
viduals by PCR amplification across a region containing 69-bp TRs revealed that the
most common allele contains six repeats whereas a less common allele contains five
repeats (10). PCR was conducted using the primers CTGGACTGCTAGCTCACCAGA
AGCCG and TTCAGAAGTGTCAGGTGCAAG located at nucleotides 242–267 and
1068–1048 in Genbank/EMBL L13283.
9. Two other polymorphisms have been identified within the MUC1 gene (34,35), one in
exon 2 and one in intron 6. Both are in linkage disequilibrium with the VNTR alleles and
can be detected by PCR-based techniques (35). Here we describe the protocol for detec-
tion of the CA microsatellite polymorphism in intron 6—the easier of the two sites to
assess. Three common alleles of 176, 178, and 180 bp corresponding to CA
11
, CA
12
, and
CA
13
are detected in Europeans.
10. 10X TBE stock comes out of solution when cold.
11. SSC for hybridization is autoclaved.
12. Ethidium bromide should not be included in the gel because it distorts the electrophoretic
separation and mobilities, particularly of MUC2.
13. Steps 11–13 are only for passive blotting. For vacuum blotting, the same solutions are
used, but as recommended by the manufacturer of the vacuum blotter.
14. Several filters can be probed together, with a blank filter layered on top.
Detection of Mucin Gene Polymorphism 347
15. The Raoul markers are also visible after transfer, since they are usually revealed with the
MUC probes.
16. Despite all the size markers, slight gel-to-gel variations mean that it is not possible to size
the bands more accurately. Analysis of individual gels makes it apparent that several
alleles exist within each size range, with the exception of MUC6 (with a repeat unit of
507 bp), but it is not practicable to rerun large numbers of samples in different combina-
tions to assign the alleles more precisely, and, in any case, alleles that differ by a single
repeat unit are unlikely to be separated on these gels.
17. The reaction mix is covered with mineral oil (Sigma) unless a PCR machine with a heated
cover is used.
Acknowledgments
The authors are grateful for the support of the British Lung Foundation. They also
wish to thank Drs. J. P. Aubert, N. Porchet, P. Pigny, D. Mitchell, J. R. Gum, N. Toribara,
M. Sarner, and J. Lennard-Jones for their collaboration and contributions to this work.
References
1. Pigny, P., Guyonnet-Dupérat, V., Hill, A. S., Pratt, W. S., Galiègue-Zouitina, S., Collyn
d’Hooge, M., Laine, A., Van-Seuningen, I., Degand, P., Gum, J. R., Kim, Y. S., Swallow,
D. M., Aubert, J P., and Porchet, N. (1996) Human mucin genes assigned to 11p15. 5:
identification and organisation of a cluster of genes. Genomics 38, 340–352.
2. Shankar, V., Pichan, P., Eddy, R. L., Tonk, V., Nowak, N., Sait, S. N. J., Shows, T. B.,
Schultz, R. E., Gotway, G., Elkins, R. C., Gilmore, M. S., and Sachdev, G. P. (1997)
Chromosomal localisation of a human mucin gene (MUC8) and cloning of the cDNA
corresponding to the carboxy terminus. Am. J. Respir. Physiol. Cell. Biol. 16, 232–241.
3. Gendler, S. J. and Spicer, A. P. (1995) Epithelial mucin genes. Annu. Rev. Physiol. 57,
607–634.
4. Gum, J. R., Ho, J. L., Pratt, W. S., Hicks, J. W., Hill, A. S., Vinall, L. E., Roberton, A. M.,
Swallow, D. M., and Kim, Y. S. (1997) MUC3 Human intestinal mucin. J. Biol. Chem.
272, 26,678–26,686.
5. Khatri, I. A., Forstner, G. G., and Forstner, J. F. (1997) The carboxyl-terminal sequence of
rat intestinal mucin RMuc3 contains a putative transmembrane region and two EGF-like
motifs. Biochim. Biophys. Acta 1326, 7–11.
6. Shekels, L. L., Hunninghake, D. A., Tisdale, A. S., Gipson, I. K., Kieliszewski, M., Kozak,
C. A., and Ho, S. B. (1998) Cloning and characterisation of mouse intestinal MUC3: 3'
sequence contains EGF-like domains. Genbank/EMBL AF027137.
7. Nollet, S., Moniaux, N., Maury, J., Petitprez, D., Degand, P., Laine, A., Porchet, N., and
Aubert, J P. (1998) Human mucin gene MUC4: organisation of its 5'-region and polymor-
phism of its central tandem repeat array. Biochem. J. 332, 739–748.
7a. Crawley, S. C., Gum, J. R. Jr., Hicks, J. W., Pratt, W. S., Aubert, J. P., Swallow, D. M.,
and Kim, Y. S. (1999) Genomic organization and structure of the 3' region of human
MUC3: alternative splicing predicts membrane-bound and soluble forms of the mucin.
Biochem. Biophys. Res. Commun. 263, 728–736.
7b. Williams, S. J., Munster, D. J., Quin, R. J., Gotley, D. C., and McGuckin, M. A. (1999)
The MUC3 gene encodes a transmembrane mucin and is alternatively spliced. Biochem.
Biophys. Res. Commun. 261, 83–89.
348 Vinall et al.
7c. Moniaux, N., Nollet, S., Porchet, N., Degand, P., Laine, A., and Aubert, J. P. (1999) Com-
plete sequence of the human mucin MUC4: a putative cell membrane-associated mucin.
Biochem. J. 338, 325–333.
8. Chang, S K., Dohrman, A. F., Basbaum, C. B., Ho, S. B., Tsuda, T., Toribara, N. W.,
Gum, J. R., and Kim, Y. S. (1994) Localization of mucin (MUC2 and MUC3) messenger
RNA and peptide expression in human normal intstine and colon cancer. Gastroenterol-
ogy 107, 28–36.
9. Audie, J. P., Janin, A., Porchet, N., Copin, C., Gosselin, B., and Aubert, J. P. (1993)
Expression of human mucin genes in respiratory, digestive, and reproductive tracts.
J. Histochem. Cytochem 41, 1479–1485.
10. Biesbrock, A. R., Bobek, L. A., and Levine, M. J. (1997) MUC7 gene expression and
genetic polymorphism. Glycoconjugate J. 14, 415–422.
11. Bobek, L. A., Liu, J., Saint, S. N. J., Shows, T. B., Bobek, Y. A., and Levine, M. J. (1996)
Structure and chromosomal localization of human salivary mucin gene, MUC7. Genomics
31, 277–282.
12. Gendler, S., Taylor-Papadimitriou, J., Duhig, T., Rothbard, J., and Burchell, J. (1988) A
highly immunogenic region of a human polymorphic epithelial mucin expressed by carci-
nomas is made up of tandem repeats. J. Biol. Chem. 263, 12,820–12,823.
13. Gum, J. R., Byrd, J. C., Hicks, J. W., Toribara, N. W., Lamport, D., and Kim, Y. S. (1989)
Molecular cloning of human intestinal mucin cDNAs. Sequence analysis and evidence for
genetic polymorphism. J. Biol. Chem. 264, 6480–6487.
14. Dufossé, J., Porchet, N., Audié, J. P., Guyonnet, D. V., Laine, A., VanSeuningen, I.,
Marrakchi, S., Degand, P., and Aubert, J. P. (1993) Degenerate 87-base-pair tandem
repeats create hydrophilic/hydrophobic alternating domains in human mucin peptides
mapped to 11p15. Biochem. J. 293, 329–337.
15. Guyonnet-Dupérat, V., Audié, J P., Debailleul, V., Laine, A., Buisine, M P., Galiègue-
Zouitina, S., Pigny, P., Degand, P., Aubert, J P., and Porchet, N. (1995) Characterization
of the human mucin gene MUC5AC: a consensus cysteine-rich domain for 11p15 mucin
genes? Biochem. J. 305, 211–219.
16. Toribara, N. W., Gum, J. J., Culhane, P. J., Lagace, R. E., Hicks, J. W., Petersen, G. M.,
and Kim, Y. S. (1991) MUC-2 human small intestinal mucin gene structure. Repeated
arrays and polymorphism. J. Clin. Invest. 88, 1005–1013.
17. Toribara, N., Roberton, A., Ho, S., Kuo, W., Gum, E., Hicks, J., Gum, J. J., Byrd, J.,
Siddiki, B., and Kim, Y. (1993) Human gastric mucin. Identification of a unique species
by expression cloning, J. Biol. Chem. 268, 5879–5885.
18. Fox, M. F., Lahbib, F., Pratt, W., Attwood, J., Gum, J. R., Kim, Y., and Swallow, D. M.
(1992) Regional localisation of the intestinal mucin gene MUC3 to chromosome 7q22.
Ann. Hum. Genet. 56, 281–287.
19. Gross, M S., Guyonnet-Dupérat, V., Porchet, N., Bernheim, A., Aubert, J. P., and Nguyen,
V., C, (1992) Mucin 4 (MUC4) gene: regional assignment (3q29) and RFLP analysis. Ann.
Genet. 35, 21–26.
20. Griffiths, B., Mathews, D. J., West, L., Attwood, J., Povey, S., Swallow, D. M., Gum,
J. R., and Kim, Y. S. (1990) Assignment of the polymorphic intestinal mucin gene (MUC2)
to chromosome 11p15. Ann. Hum. Genet. 54, 277–285.
21. Pigny, P., Pratt, W. S., Laine, A., Leclercq, A., Swallow, D. M., Nguyen, V. C., Porchet,
N., and Aubert, J P. (1995) The MUC5AC gene: RFLP analysis with the Jer 58 probe.
Hum. Genet. 96, 367–368.
Detection of Mucin Gene Polymorphism 349
22. Swallow, D. M., Gendler, S., Griffiths, B., Corney, G., Taylor-Papadimitriou, J., and
Bramwell, M. E. (1987) The human tumour-associated epithelial mucins are coded by an
expressed hypervariable gene locus PUM. Nature 328, 82–84.
23. Karlsson, S., Swallow, D. M., Griffiths, B., Corney, G., and Hopkinson, D. A. (1983) A
genetic polymorphism of a human urinary mucin. Ann. Hum. Genet. 47, 263–269.
24. Hareuveni, M., Tsarfaty, I., Zaretsky, J., Kotkes, P., Horev, J., Zrihan, S., Weii, M., Green,
S., Lathe, R., Keydar, I., and Wreschner, D. N. (1990) A transcribed gene, containing a
variable number of tandem repeats, codes for a human epithelial tumor antigen. cDNA
cloning, expression of the transfected gene and over-expression in breast cancer tissue.
Eur. J. Biochem. 189, 475–486.
25. Ligtenberg, M., Vos, H. L., Gennissen, A., and Hilkens, J. (1990) Episialin, a carcinoma-
associated mucin, is generated by a polymorphic gene encoding splice variants with alter-
native amino termini. J. Biol. Chem. 265, 5573–5578.
26. Vinall, L. E., Hill, A. S., Pigny, P., Pratt, W. S., Toribara, N., Gum, J. R., Young, K. I., Porchet,
N., Aubert, J. P., and Swallow, D. M. (1998) Variable number tandem repeat polymorphism of
the mucin genes located in the complex on 11p15. 5. Hum. Genet. 102, 357–366.
27. Debailleul, V., Laine, A., Huet, G., Mathon, P., Collyn d’Hooghe, M., Aubert, J. P., and
Porchet, N. (1998) Human mucin genes MUC2, MUC3, MUC4, MUC5AC, MUC5B and
MUC6 express stable and extremely large mRNAs and exhibit a variable length polymor-
phism. An improved method to analyse large size RNAs. J. Biol. Chem. 273, 881–890.
27a. Hermann, A., Davies, J. R., Lindell, G., Martensson, S., Packer, N. H., Swallow, D. M.,
and Corstedt, I. (1999) Studies on the insoluable glycoprotein complex from human colon:
identification of reduction-insensitive MUC2 oligomers and C-terminal cleavage. J. Biol.
Chem. 274, 15,828–15,836.
28. Gum, J. R., Hicks, J. W., Toribara, N. W., Siddiki, B., and Kim, Y. S. (1994) Molecular
cloning of human intestinal mucin (MUC2) cDNA-identification of the amino-terminus
and overall sequence similarity to pre-pro von-Willibrand. J. Biol. Chem. 269, 2440–2446.
29. Brunner, C., Lobentanz, E M., Petho-Schramm, A., Ernst, A., Kang, C., Dieplinger, H.,
Muller, H. J., and Uterman, G. (1996) The number of identical Kringle IV repeats in
Apolipoprotein (a) affects its processing and secretion by HepG2 cells. J. Biol. Chem.
271, 32,403–32,410.
30. Yonezawa, S., Byrd, J. C., Dahiya, R., Ho, J., Gum, J. R., Griffiths, B., Swallow, D. M.,
and Kim, Y. S. (1991) Differential mucin gene expression in human pancreatic and colon
cancer cells. Biochemical J. 276, 599–605.
31. Gum, J. R., Hicks, J. W., Swallow, D. M., Lagace, R. L., Byrd, J. C., Lamport, D., Siddiki,
B., and Kim, Y. S. (1990) Molecular cloning of cDNAs derived from a novel human intes-
tinal mucin gene. Biochem. Biophys. Res. Commun. 171, 407–415.
32. Porchet, N., Cong, N. V., Dufosse, J., Audie, J. P., Guyonnet-Dupérat, V., Gross, M. S.,
Denis, C., Degand, P., Bernheim, A., and Aubert, J. P. (1991) Molecular cloning and chro-
mosomal localization of a novel human tracheo-bronchial mucin cDNA containing tandemly
repeated sequences of 48 base pairs. Biochem. Biophys. Res. Commun. 175, 414–422.
33. Carvalho, F., Seruca, R., David, L., Amorim, A., Seixas, M., Bennett, E., Clausen, H., and
Sobrinho-Simoes, M. (1997) MUC1 gene polymorphism and gastric cancer- an epidemio-
logical study. Glycoconjugate J. 14, 107–111.
33a. Moniaux, N., Nollet, S., Porchet, N., Degand, P., Laine, A., and Aubert, J P. (1999) Com-
plete sequence of the human mucin MUC4: a putative cell membrane-associated mucin.
Biochem. J. 338, 325–333.
Không có nhận xét nào:
Đăng nhận xét